Compound Repeats of Pyrus pyrifolia chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_015996 | (T)15act(A)15 | c | 166 | 198 | 33 | Design Primer |
| 2 | NC_015996 | (C)10(A)13 | c | 5637 | 5659 | 23 | Design Primer |
| 3 | NC_015996 | (A)14tggattcatggtaaaatccttacatgatgca(T)10 | c | 38576 | 38630 | 55 | Design Primer |
| 4 | NC_015996 | (A)16tgaaat(TTTA)3 | c | 39192 | 39225 | 34 | Design Primer |
| 5 | NC_015996 | (T)11agtatttattttatttagcccacccaataact(A)10 | c | 52266 | 52318 | 53 | Design Primer |
| 6 | NC_015996 | (A)10gtgcattagaagtgtcgttcg(A)16 | c | 68686 | 68732 | 47 | Design Primer |
| 7 | NC_015996 | (AATTG)3aatcaaaataaaattccaatccaaactcaaatgcggattgacg(T)11 | c | 71722 | 71790 | 69 | Design Primer |
| 8 | NC_015996 | (A)13gaatcaatgtgtagatgtagattctagcgttttct(TTTA)3(T)15cataccaggcttttaacttataaaaaggggcttttctttcatttttcaaaaaagatgggttttggcctgttttgtttatctat(A)11 | c | 74642 | 74810 | 169 | Design Primer |
| 9 | NC_015996 | (T)19acttat(TTTA)3 | c | 83025 | 83061 | 37 | Design Primer |
| 10 | NC_015996 | (A)22ttttatcttaattaattgtttctgagtcaccggttcttatttcttttcttttgaaaggggtcggttaat(A)10 | c | 116439 | 116539 | 101 | Design Primer |