Compound Compound Repeats of Lygodium japonicum chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_022136 | (GAAA)3tagatatcta(TTTC)3 | c | 53912 | 53945 | 34 | Design Primer |
| 2 | NC_022136 | (GTTG)3gcgtgtttcgaacagataaaatgattggttcagaatattcctaaccgcggtgatttttcaaatatccccgaaatcagat(TTA)4 | c | 67985 | 68087 | 103 | Design Primer |
| 3 | NC_022136 | (G)13tggtgcggaagatcccggtcgtagttgatcccgtcatggtttggccta(C)13 | c | 110305 | 110378 | 74 | Design Primer |
| 4 | NC_022136 | (G)13taggccaaaccatgacgggatcaactacgaccgggatcttccgcacca(C)13 | c | 132331 | 132404 | 74 | Design Primer |