All Repeats of Phyllodactylus unctus mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_020038 | (CGCC)3 | p4 | 552 | 563 | 12 | Design Primer |
| 2 | NC_020038 | (C)11 | p1 | 2590 | 2600 | 11 | Design Primer |
| 3 | NC_020038 | (ACCTAC)5(ACCCAT)5acccgtacctatacccatacccatacct(ATACCC)4atacct(ATACCC)4atacct(ATACCC)3 | c | 16366 | 16531 | 166 | Design Primer |