Compound Compound Repeats of Cymbidium tortisepalum voucher KUN:HJL091027 chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_021431 | (AAATAT)3aaaaatataaataaaaatataaatatataaa(AT)8 | c | 4703 | 4767 | 65 | Design Primer |
| 2 | NC_021431 | (AT)7aatttatatataatataattaat(ATATA)3 | c | 27968 | 28019 | 52 | Design Primer |
| 3 | NC_021431 | (A)13gaatgaatatcgaccgttccactactccaagctgcactgtaaaaatgaaggaggaggaaaggc(AT)6 | c | 47506 | 47593 | 88 | Design Primer |
| 4 | NC_021431 | (T)11cacaattcataatcagatttcttttttatt(A)10 | c | 83501 | 83551 | 51 | Design Primer |
| 5 | NC_021431 | (T)10attttttggagttctttataaataggttc(A)10 | c | 127234 | 127282 | 49 | Design Primer |