Compound Compound Repeats of Cymbidium aloifolium voucher KUN:YJB100604 chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_021429 | (TCATA)3taattc(AT)6 | c | 100 | 132 | 33 | Design Primer |
| 2 | NC_021429 | (TTAT)3aactcctttccaaaaacaaaaat(A)10 | c | 12359 | 12403 | 45 | Design Primer |
| 3 | NC_021429 | (TA)6tctatttatatgtatatctatttatatgtgtat(TA)8 | c | 55329 | 55389 | 61 | Design Primer |
| 4 | NC_021429 | (ATAG)3ataatttttttgtc(T)11 | c | 67493 | 67529 | 37 | Design Primer |