All Repeats of Bufo tibetanus mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_020048 | (CCCT)3 | p4 | 11472 | 11483 | 12 | Design Primer |
| 2 | NC_020048 | (AAAC)3 | p4 | 13438 | 13449 | 12 | Design Primer |
| 3 | NC_020048 | (C)10tccccccccaaaagacctgcttcatcacccgtctttttactatgagtttcccatgcgtttttagcaaa(C)10tccccccccataggcttaaccattagttttctctgtaaccccccggaaccagaagcacttgatggctatcaacacctatgagttatttgaaa(C)17 | c | 17099 | 17295 | 197 | Design Primer |