Compound Repeats of Fragaria mandshurica plastid
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_018767 | (TA)6tttttttattt(TA)6 | c | 6988 | 7022 | 35 | Design Primer |
| 2 | NC_018767 | (A)15gaat(A)11 | c | 8636 | 8665 | 30 | Design Primer |
| 3 | NC_018767 | (TAT)5tttnnnnnn(TAT)4 | c | 10426 | 10461 | 36 | Design Primer |
| 4 | NC_018767 | (T)11ctttatttagn(A)10 | c | 15773 | 15804 | 32 | Design Primer |
| 5 | NC_018767 | (TA)6atacagatgcatgatacagcaagcatgccccttgttttgtaaagt(A)18 | c | 36556 | 36630 | 75 | Design Primer |
| 6 | NC_018767 | (T)10caagtgcggaaaccccaggaccagaagtagtaggatttattttcataataaaatatgtcgaaattttttgcgaaaatggctgaaatcaa(AAAT)3 | c | 55691 | 55801 | 111 | Design Primer |