Compound Repeats of Thelazia callipaeda mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_018363 | (T)13gtttaaaagtaatagtttggttttttgttttatgggtttggaaa(T)14cttttggcccggg(T)13ggggagttttattttta(T)17ggaattatgtctagagtttgtggcttggtta(T)11 | c | 4872 | 5044 | 173 | Design Primer |
2 | NC_018363 | (T)11aatataaa(T)14 | c | 6507 | 6539 | 33 | Design Primer |
3 | NC_018363 | (T)13gttacaaaattaaaaata(T)10 | c | 8284 | 8324 | 41 | Design Primer |
4 | NC_018363 | (T)10attattttagtttttattatttttgaattagaagttataatttttattattttaattcaagttgatttatttggttttttttc(T)10 | c | 9316 | 9418 | 103 | Design Primer |
5 | NC_018363 | (T)10aattataatgtgttagaatttaaaaataagttttttatggatagtttttctttgtttatttatcattttttccccaagtttttttatttagataatttta(T)11aatta(T)10agttttgttagatttttttc(T)11cttttgttttgcggggcggtgtttattcaggtttttttttatta(T)11 | c | 11174 | 11395 | 222 | Design Primer |
6 | NC_018363 | (T)10g(T)10 | c | 12036 | 12056 | 21 | Design Primer |