Compound Repeats of Gossypium herbaceum subsp. africanum chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_016692 | (T)10caattgaaaattccc(AAT)4 | c | 13524 | 13560 | 37 | Design Primer |
| 2 | NC_016692 | (C)14tttttttcctaatca(T)10 | c | 14674 | 14712 | 39 | Design Primer |
| 3 | NC_016692 | (T)10atttttattttaaggaattgcttagtcgtctagtaacaagtaagagtagtcgttagatatagat(A)10 | c | 69435 | 69518 | 84 | Design Primer |
| 4 | NC_016692 | (T)10cggaaaagttcaaaaatactatgatggctccgttgctttatatatttatttcgtctgtgattcagcaatcccaaagtttc(T)10 | c | 74658 | 74757 | 100 | Design Primer |