Compound Compound Repeats of Silene noctiflora mitochondrion chromosome 19
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_016398 | (GCCG)3ataggcaaaagaaaatccactagtttagt(TCTGA)3 | c | 15666 | 15721 | 56 | Design Primer |
2 | NC_016398 | (CCCG)3gccggtacgtcaagtata(TCGC)3 | c | 63385 | 63426 | 42 | Design Primer |
3 | NC_016398 | (AAG)4aatgtggtgcaggaggtgaaagcagaaagtggcattcttagattagacaagcatagttgaataaaagcaagcaagaaggaattccaactcaagtcc(TAGGG)3 | c | 88973 | 89095 | 123 | Design Primer |