All Repeats of Sepia officinalis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_007895 | (AT)13(GT)7 | c | 9495 | 9534 | 40 | Design Primer |
| 2 | NC_007895 | (TTAT)4aagaccacaacttatcgttttaatttaaactaactttatta(AT)6 | c | 11842 | 11910 | 69 | Design Primer |
| 3 | NC_007895 | (TAA)4 | p3 | 15314 | 15325 | 12 | Design Primer |