All Repeats of Hyla chinensis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_006403 | (C)18 | p1 | 17112 | 17129 | 18 | Design Primer |
| 2 | NC_006403 | (C)17 | p1 | 17279 | 17295 | 17 | Design Primer |
| 3 | NC_006403 | (C)14attacctcgcacggtttccccacagatcttaatcaaaagtagatcttctctaaacccaatgctt(CCA)4 | c | 17447 | 17536 | 90 | Design Primer |
| 4 | NC_006403 | (CCA)4 | p3 | 17985 | 17996 | 12 | Design Primer |