All Repeats of Wickerhamomyces mucosus strain CBS 6341 mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_022171 | (ATTA)3tcatttttttattatttattatattttatatatttactaatttattt(ATTA)4 | c | 490 | 564 | 75 | Design Primer |
2 | NC_022171 | (TTTA)3 | p4 | 825 | 836 | 12 | Design Primer |
3 | NC_022171 | (TAT)4tta(TATT)3 | c | 966 | 992 | 27 | Design Primer |
4 | NC_022171 | (TATT)4tatatatttaaagatag(AT)6acattatatttatttatatattttaatatag(AT)6acat(TTTA)4ttttcaaatagatag(AT)6acat(TTTA)4tatatat(TTTA)3 | c | 1247 | 1420 | 174 | Design Primer |
5 | NC_022171 | (TAAAT)5 | p5 | 1855 | 1879 | 25 | Design Primer |
6 | NC_022171 | (AT)6ggattatatttctatttattaataaatttatattaat(TA)8 | c | 2530 | 2594 | 65 | Design Primer |
7 | NC_022171 | (AAAT)3 | p4 | 3587 | 3598 | 12 | Design Primer |
8 | NC_022171 | (AT)9 | p2 | 4633 | 4650 | 18 | Design Primer |
9 | NC_022171 | (AT)6 | p2 | 4988 | 4999 | 12 | Design Primer |
10 | NC_022171 | (AT)7 | p2 | 6285 | 6298 | 14 | Design Primer |
11 | NC_022171 | (ATA)4 | p3 | 6471 | 6482 | 12 | Design Primer |
12 | NC_022171 | (AAAT)4 | p4 | 6722 | 6737 | 16 | Design Primer |
13 | NC_022171 | (AT)6 | p2 | 7136 | 7147 | 12 | Design Primer |
14 | NC_022171 | (ATA)4 | p3 | 7758 | 7769 | 12 | Design Primer |
15 | NC_022171 | (TTTA)3cttatat(TAA)7 | c | 9400 | 9439 | 40 | Design Primer |
16 | NC_022171 | (TAAT)3atatttaattatgcgactgttattaataattgaata(ATTT)3aagtttattt(TA)8 | c | 10184 | 10269 | 86 | Design Primer |
17 | NC_022171 | (TAT)4 | p3 | 10532 | 10543 | 12 | Design Primer |
18 | NC_022171 | (TAT)4 | p3 | 10802 | 10813 | 12 | Design Primer |
19 | NC_022171 | (ATA)4 | p3 | 12027 | 12038 | 12 | Design Primer |
20 | NC_022171 | (TTA)5 | p3 | 12643 | 12657 | 15 | Design Primer |
21 | NC_022171 | (TTA)4 | p3 | 13622 | 13633 | 12 | Design Primer |
22 | NC_022171 | (T)10gatttttgtaaaaataaattagttttattaaataataataagg(ATA)8 | c | 14505 | 14581 | 77 | Design Primer |
23 | NC_022171 | (T)10 | p1 | 14810 | 14819 | 10 | Design Primer |
24 | NC_022171 | (AT)7 | p2 | 16287 | 16300 | 14 | Design Primer |
25 | NC_022171 | (TAA)4 | p3 | 16411 | 16422 | 12 | Design Primer |
26 | NC_022171 | (TAT)4 | p3 | 16869 | 16880 | 12 | Design Primer |
27 | NC_022171 | (AT)8(T)10* | c* | 18157 | 18181 | 25 | Design Primer |
28 | NC_022171 | (AT)9 | p2 | 18811 | 18828 | 18 | Design Primer |
29 | NC_022171 | (ATA)4 | p3 | 18983 | 18994 | 12 | Design Primer |
30 | NC_022171 | (T)10attaataaaataattttttattaataattattgacataatcttatgttttaaattta(T)10 | c | 21264 | 21340 | 77 | Design Primer |
31 | NC_022171 | (TTA)4 | p3 | 22333 | 22344 | 12 | Design Primer |
32 | NC_022171 | (A)10tatatataatgaatattaaaaatg(A)10 | c | 22610 | 22653 | 44 | Design Primer |
33 | NC_022171 | (AT)6 | p2 | 23734 | 23745 | 12 | Design Primer |
34 | NC_022171 | (TTAT)4 | p4 | 23850 | 23865 | 16 | Design Primer |
35 | NC_022171 | (ATT)4 | p3 | 24122 | 24133 | 12 | Design Primer |
36 | NC_022171 | (AATA)3 | p4 | 24672 | 24683 | 12 | Design Primer |
37 | NC_022171 | (ATTA)3tttaattataatt(TA)9 | c | 25075 | 25117 | 43 | Design Primer |
38 | NC_022171 | (TAAAGA)3 | p6 | 25657 | 25674 | 18 | Design Primer |
39 | NC_022171 | (A)11 | p1 | 26067 | 26077 | 11 | Design Primer |
40 | NC_022171 | (TTTA)3 | p4 | 26303 | 26314 | 12 | Design Primer |
41 | NC_022171 | (TAA)4tataataaataaatttttt(ATTTA)4 | c | 26434 | 26484 | 51 | Design Primer |
42 | NC_022171 | (TAT)4taataataatatccaaaaggggttaccttttaccattactggcactgttggattataccttaataattcatat(TA)6gattctttattttatt(TA)6 | c | 27251 | 27375 | 125 | Design Primer |
43 | NC_022171 | (T)11 | p1 | 28413 | 28423 | 11 | Design Primer |
44 | NC_022171 | (TATT)3 | p4 | 28576 | 28587 | 12 | Design Primer |
45 | NC_022171 | (AATA)3 | p4 | 29206 | 29217 | 12 | Design Primer |
46 | NC_022171 | (TAA)4 | p3 | 31595 | 31606 | 12 | Design Primer |
47 | NC_022171 | (TAA)4 | p3 | 33185 | 33196 | 12 | Design Primer |
48 | NC_022171 | (T)10 | p1 | 33725 | 33734 | 10 | Design Primer |
49 | NC_022171 | (TAT)7 | p3 | 33864 | 33884 | 21 | Design Primer |
50 | NC_022171 | (TTA)4tttttcattaataaattatttattttaattcaatttattttta(T)10 | c | 34250 | 34314 | 65 | Design Primer |
51 | NC_022171 | (AT)6 | p2 | 35136 | 35147 | 12 | Design Primer |
52 | NC_022171 | (T)10 | p1 | 36689 | 36698 | 10 | Design Primer |
53 | NC_022171 | (TAT)4 | p3 | 37044 | 37055 | 12 | Design Primer |
54 | NC_022171 | (TATATT)3 | p6 | 37465 | 37482 | 18 | Design Primer |
55 | NC_022171 | (TAAA)3 | p4 | 40543 | 40554 | 12 | Design Primer |
56 | NC_022171 | (TAAT)3 | p4 | 41058 | 41069 | 12 | Design Primer |
57 | NC_022171 | (TATT)3aatttcttatattaatatttagatatatattatatatttatttatatttatttatattgatt(TA)7 | c | 41173 | 41260 | 88 | Design Primer |
58 | NC_022171 | (TATTTT)5 | p6 | 42913 | 42942 | 30 | Design Primer |
59 | NC_022171 | (ATTA)3atattgattttatca(TAT)4ttatatattttatttattcatatgatttattataaaattttacattttaaagaattatagctaatat(TTA)4 | c | 43075 | 43192 | 118 | Design Primer |
60 | NC_022171 | (TTA)4 | p3 | 43369 | 43380 | 12 | Design Primer |
61 | NC_022171 | (TA)7 | p2 | 43562 | 43575 | 14 | Design Primer |
62 | NC_022171 | (TA)8attaatataaatttattaataaatagaaatataatcc(AT)6 | c | 44047 | 44111 | 65 | Design Primer |
63 | NC_022171 | (ATTTA)5 | p5 | 44762 | 44786 | 25 | Design Primer |
64 | NC_022171 | (ATAA)3aatatat(ATAA)4aatg(TA)6tctatctatttga(AAAT)4aaaatg(TA)6tctatattaaaatatataaataaatataatg(TA)6tctatctttaaatat(ATAA)4 | c | 45220 | 45391 | 172 | Design Primer |
65 | NC_022171 | (ATAA)3atata(AAT)4 | c | 45646 | 45674 | 29 | Design Primer |
66 | NC_022171 | (TAAA)3 | p4 | 45805 | 45816 | 12 | Design Primer |
67 | NC_022171 | (TAAT)4aaataaattagtaaatatataaaatataataaataataaaaaaatga(TAAT)3 | c | 46077 | 46151 | 75 | Design Primer |