All Repeats of Lygus lineolaris mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_021975 | (TTA)4 | p3 | 410 | 421 | 12 | Design Primer |
| 2 | NC_021975 | (AT)6 | p2 | 6317 | 6328 | 12 | Design Primer |
| 3 | NC_021975 | (ATAA)3 | p4 | 14484 | 14495 | 12 | Design Primer |
| 4 | NC_021975 | (TGGA)4tgggggggtagccctcttacatagctctctcatagagaccaatctggttttactttttcttata(T)10 | c | 15531 | 15620 | 90 | Design Primer |