Compound Repeats of Triticum monococcum chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_021760 | (TCCT)3acagctgatagggaaaaatcgttgtttttacgatccctatgtagaaagccctttttttctagtatttactagaaaatttgatcctctc(T)11 | c | 42849 | 42959 | 111 | Design Primer |
| 2 | NC_021760 | (TAT)4ttatcctc(T)10 | c | 47401 | 47430 | 30 | Design Primer |
| 3 | NC_021760 | (T)10ctctccta(T)10 | c | 76973 | 77000 | 28 | Design Primer |