All Repeats of Phaeocystis globosa strain Pg-G(A) chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_021637 | (TTAA)3attacaatgaaatattatatttgctagcaaaacggtactaaaaccatataaaaa(TTAT)3 | c | 67 | 144 | 78 | Design Primer |
| 2 | NC_021637 | (TAAA)3 | p4 | 21267 | 21278 | 12 | Design Primer |
| 3 | NC_021637 | (GTTGGT)3 | p6 | 31884 | 31901 | 18 | Design Primer |
| 4 | NC_021637 | (AT)6 | p2 | 52872 | 52883 | 12 | Design Primer |
| 5 | NC_021637 | (GGAA)3 | p4 | 62883 | 62894 | 12 | Design Primer |
| 6 | NC_021637 | (AAT)5 | p3 | 84797 | 84811 | 15 | Design Primer |