Compound Repeats of Glycine tomentella voucher CSIRO:G1403 chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_021636 | (AT)10aa(AT)9 | c | 5171 | 5210 | 40 | Design Primer |
| 2 | NC_021636 | (A)12ttctatgtgtttcacatatatatttcaaaatttgtgacttgtaattatgataagaaatttttg(A)12 | c | 13366 | 13452 | 87 | Design Primer |
| 3 | NC_021636 | (T)10cttatattttcttattaaatta(TATC)3tataattctatctat(ATAG)3 | c | 18381 | 18451 | 71 | Design Primer |
| 4 | NC_021636 | (C)11(A)10 | c | 31374 | 31394 | 21 | Design Primer |
| 5 | NC_021636 | (A)12tgaaaaaggttttcaattttgggtcttagtct(A)11 | c | 31892 | 31946 | 55 | Design Primer |
| 6 | NC_021636 | (ATAG)3atatagatattcgattagcatatattagcatatattactatatattggatattc(A)10 | c | 47208 | 47283 | 76 | Design Primer |
| 7 | NC_021636 | (T)10gaattagaattttcatttttattgtattt(TA)6 | c | 54742 | 54792 | 51 | Design Primer |
| 8 | NC_021636 | (T)10catatgttatgttttcttctaattaaaataaaaattgttaaaagttttctggtatg(A)10 | c | 69898 | 69973 | 76 | Design Primer |
| 9 | NC_021636 | (A)11ttagaaaacaatataaatacgatcttttatcctataattttatcaattatgcagataagaaagactcatatatttatggatataaatccctatttcacgt(A)10 | c | 112809 | 112929 | 121 | Design Primer |