Compound Compound Repeats of Cymbidium mannii voucher KUN:YJB100602 chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_021433 | (A)12taaata(T)10 | c | 1401 | 1428 | 28 | Design Primer |
2 | NC_021433 | (T)16c(T)16 | c | 54925 | 54957 | 33 | Design Primer |
3 | NC_021433 | (AAG)4atactgagattaggataggaagaattcatagttagaaaaaattgt(ATTA)3 | c | 67850 | 67918 | 69 | Design Primer |