Compound Repeats of Butomus umbellatus mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_021399 | (TCAT)3(TGAT)3 | c | 23801 | 23824 | 24 | Design Primer |
| 2 | NC_021399 | (AG)6gtgagtcgagaggggaattccgcttcgcttgaccgattcctcggagtcggaggaagatggaccctgaacaaaagaaggaactgctct(A)10 | c | 28167 | 28275 | 109 | Design Primer |
| 3 | NC_021399 | (TACCC)3cacgagcctgatgttctgctgctctctgtgtctgtcgaagcagacgctctattcgcggtatccccttctgagagatgagataggtagac(TCT)4 | c | 255080 | 255195 | 116 | Design Primer |
| 4 | NC_021399 | (AGA)4gaagattgcctctccggtggagaaaaaggtgcagtcatcta(C)11 | c | 448557 | 448620 | 64 | Design Primer |