Compound Compound Repeats of Adoxophyes orana mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_021396 | (TAAA)3taatataaataatataacaattatccataaaacaaatc(TAAA)3 | c | 6346 | 6407 | 62 | Design Primer |
2 | NC_021396 | (A)10taacatcttgataaataaaataaatt(A)12ttaattatact(A)11 | c | 7973 | 8042 | 70 | Design Primer |
3 | NC_021396 | (TTAA)3tgagcttgtaaaagcatttgttttgaaaacttaagaaagaattaaatattctattaa(T)11 | c | 11602 | 11681 | 80 | Design Primer |
4 | NC_021396 | (T)10atttgaact(A)11ttacgctgttatccctaaggtaatttaatcttataatcaaaaattttggatc(ATTT)3attaatatt(TA)34 | c | 12941 | 13111 | 171 | Design Primer |
5 | NC_021396 | (AT)6taatatattaaatattta(AT)10 | c | 15221 | 15270 | 50 | Design Primer |