Compound Compound Repeats of Jakoba libera strain ATCC 50422 mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_021127 | (AAAG)3tatagta(AAAG)3 | c | 18585 | 18615 | 31 | Design Primer |
2 | NC_021127 | (TCTTT)3tcttctcctttatctaatc(TTCAT)3 | c | 95315 | 95363 | 49 | Design Primer |
3 | NC_021127 | (TACTTC)7tatttccacttctgctcaaataccctcttcctcagcttcag(CTTCTA)7 | c | 95508 | 95632 | 125 | Design Primer |