Compound Repeats of Pleodorina starrii plastid
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_021109 | (ATA)5(TTA)4 | c | 61701 | 61727 | 27 | Design Primer |
| 2 | NC_021109 | (T)14atgt(TA)6 | c | 147571 | 147600 | 30 | Design Primer |
| 3 | NC_021109 | (G)16a(G)20 | c | 153678 | 153714 | 37 | Design Primer |
| 4 | NC_021109 | (G)18cttaacgacatagtttttt(G)10 | c | 157885 | 157931 | 47 | Design Primer |
| 5 | NC_021109 | (C)10tttaggcacgacatttatgttcgctggatgtaccaacaagctgatttataacggggggt(G)27 | c | 169846 | 169941 | 96 | Design Primer |
| 6 | NC_021109 | (G)13ttctttaacaagaaactacctaaatttagttctataaaaaatagga(G)16 | c | 213714 | 213788 | 75 | Design Primer |