Compound Compound Repeats of Euglena viridis culture-collection ATCC:PRA110 chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_020460 | (TTA)5ttgtaagaattttatagatttaagatttattgagtggttttactatggtttgagttggtatgtgattagctttgattattttggg(TATT)4 | c | 14057 | 14172 | 116 | Design Primer |
2 | NC_020460 | (T)11acaaattaatatg(T)10 | c | 15896 | 15929 | 34 | Design Primer |
3 | NC_020460 | (TAAA)3tttact(ATTA)4 | c | 60388 | 60421 | 34 | Design Primer |