Compound Compound Repeats of Gonium pectorale chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_020438 | (AT)7catt(A)15 | c | 23675 | 23707 | 33 | Design Primer |
| 2 | NC_020438 | (ATA)4tagcttatcaaaaaatgataagcta(TAT)4 | c | 79073 | 79121 | 49 | Design Primer |
| 3 | NC_020438 | (ATAA)3tattttaaaataaatagataaggctaattacagtatcttaattttattgtttaaaatttttttctttttacacttatttatttttttaaaatat(A)10 | c | 138831 | 138946 | 116 | Design Primer |
| 4 | NC_020438 | (A)11taaatttgctcgttcctctatcctcaggatagatcacaatttattttgatagttcaa(CTCG)3 | c | 139662 | 139741 | 80 | Design Primer |
| 5 | NC_020438 | (AAAAT)3taggagttttataaagtattatcttttattttatctaaaaaaaagcaaaatgacaactacataaacatttaattctt(A)16 | c | 168983 | 169090 | 108 | Design Primer |