Compound Compound Repeats of Salvia miltiorrhiza chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_020431 | (A)11gaactaaaaataataaaatagaatattaatatataaataaaat(ATAA)3 | c | 8147 | 8212 | 66 | Design Primer |
2 | NC_020431 | (A)10cgaatcgaatgcaaaaccaaaatacttagaggactcttctgac(A)15 | c | 12234 | 12301 | 68 | Design Primer |
3 | NC_020431 | (A)12gaaatagaaattaaatc(AATA)3 | c | 68039 | 68079 | 41 | Design Primer |
4 | NC_020431 | (T)11gctctttcaagatgattcccaaaaataaaat(A)12 | c | 72821 | 72874 | 54 | Design Primer |