Compound Compound Repeats of Chrysanthemum indicum voucher HeN001 chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_020320 | (TA)7(T)10 | c | 30962 | 30985 | 24 | Design Primer |
| 2 | NC_020320 | (AT)6ttatttaattaaagaatagaatttcaaataactgtaaaatattatagaacataacgatgaatctagcgatatagaactagt(A)14 | c | 46193 | 46299 | 107 | Design Primer |
| 3 | NC_020320 | (T)10ctaatttttatttgaattctatattagttatagttaagttattaggaattggtcaaaattgacatcgatttgtattatcttttctattttattatc(TTTA)3 | c | 50197 | 50314 | 118 | Design Primer |
| 4 | NC_020320 | (TTAA)3attttatattcatata(AT)6 | c | 125965 | 126004 | 40 | Design Primer |