Compound Compound Repeats of Cycas revoluta chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_020319 | (ATAG)3a(TATC)3 | c | 220 | 244 | 25 | Design Primer |
| 2 | NC_020319 | (A)10ta(G)10 | c | 27191 | 27212 | 22 | Design Primer |
| 3 | NC_020319 | (G)11tgaatgaaaagaatcaattcgaaagtgagaattacaaattcgaaattgtaaat(A)13 | c | 65863 | 65939 | 77 | Design Primer |
| 4 | NC_020319 | (A)11taaggggaaagacggctcaaaaagtggaggaataggattttatgatggttgagcattacctaagcatacttgagctatgagtatgaattatttc(T)11ccttttttgtagaaggaaaagtactaagttcatatagc(CTAT)3(ATAG)3 | c | 108511 | 108688 | 178 | Design Primer |
| 5 | NC_020319 | (ATAG)3a(TATC)3 | c | 138864 | 138888 | 25 | Design Primer |
| 6 | NC_020319 | (A)11g(A)13 | c | 159910 | 159934 | 25 | Design Primer |
| 7 | NC_020319 | (ATAG)3a(TATC)3 | c | 162365 | 162389 | 25 | Design Primer |