All Repeats of Alvinocaris longirostris mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_020313 | (A)10 | p1 | 10238 | 10247 | 10 | Design Primer |
| 2 | NC_020313 | (CAAA)3ctcttctctaaataactctagactagaatctttacacacccaaccgaacccgcttcatttc(T)20 | c | 13570 | 13662 | 93 | Design Primer |
| 3 | NC_020313 | (TA)7 | p2 | 14233 | 14246 | 14 | Design Primer |