All Repeats of Telmatobius bolivianus mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_020002 | (TAAC)3 | p4 | 1142 | 1153 | 12 | Design Primer |
2 | NC_020002 | (C)15 | p1 | 5297 | 5311 | 15 | Design Primer |
3 | NC_020002 | (TATT)3 | p4 | 10552 | 10563 | 12 | Design Primer |
4 | NC_020002 | (C)11atagatttcatcactagttttctcttgtaaccccccggaatcaggagtacttgatgactaatttctataggtatttttacgcaa(C)11atagatttcatcactagttttctcttgtaaccccccggaatcaggagtacttgatgactaatttctataggtatttttacgcaa(C)11atagatttcatcactagttttctcttgtaaccccccggaatcaggagtacttgatgactaatttctataggtatttttacacaa(C)12 | c | 17102 | 17398 | 297 | Design Primer |