Compound Compound Repeats of Festuca altissima plastid
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_019648 | (T)15atatatatattatttattatttattttcttgttttgtatctagcaaaattgtaaggtagaaaacataaaagatcctggattctccatttaattcgt(A)12 | c | 45341 | 45463 | 123 | Design Primer |
| 2 | NC_019648 | (A)10cataaactcttccattgaagggtgg(T)10 | c | 60695 | 60739 | 45 | Design Primer |
| 3 | NC_019648 | (T)10ctctccta(T)10 | c | 75965 | 75992 | 28 | Design Primer |
| 4 | NC_019648 | (AACA)3aataataaggttttggaataatctgaattgacctatcaaaaaataattccaattatttaatatgaataatttgg(ATTA)4 | c | 104557 | 104658 | 102 | Design Primer |