Compound Repeats of Pellia endiviifolia chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_019628 | (TA)9(AT)6 | c | 22818 | 22847 | 30 | Design Primer |
| 2 | NC_019628 | (A)10ttaatagaaaattagtttggattgaagcaactttgaatgatttacgtatgtggaaacgccattacttatcgatagatgaag(A)10 | c | 61615 | 61715 | 101 | Design Primer |
| 3 | NC_019628 | (TTTG)3gatttggttgtgtcatagctataa(T)10 | c | 64263 | 64308 | 46 | Design Primer |