All Repeats of Neotetracus sinensis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_019626 | (A)10 | p1 | 67 | 76 | 10 | Design Primer |
| 2 | NC_019626 | (TCA)4 | p3 | 10588 | 10599 | 12 | Design Primer |
| 3 | NC_019626 | (ACGCAT)3acgcacacgcacacgcatacgcacacgcacacgcatacgcac(ACGCAT)3acgcacacgcacacgcatacgcacacgcac(ACGCAT)3acgcacacgcacacgcatacgcatacgcac(ACGCAT)4acgcacacgcatacgcatacgcac(ACGCAT)3acgcacacgcatacgcatacgcacacacgca(CACG)3 | c | 16493 | 16757 | 265 | Design Primer |