Compound Compound Repeats of Fragaria vesca subsp. bracteata chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_018766 | (T)10attttatatatnnnatatanntttttttatgatat(A)10taataatattatctattatattat(TA)6 | c | 6997 | 7087 | 91 | Design Primer |
2 | NC_018766 | (A)15gaat(A)10 | c | 8637 | 8665 | 29 | Design Primer |
3 | NC_018766 | (T)10ctttatttag(A)11 | c | 15762 | 15792 | 31 | Design Primer |
4 | NC_018766 | (TA)6atacagatgcatgatacagcaagcatgccccttgttttgtaaagt(A)15 | c | 36571 | 36642 | 72 | Design Primer |
5 | NC_018766 | (T)10caagtgcggaaaccccaggaccagaagtagtaggatttattttcataataaaatatgtcgaaattttttgcgaaaatggctgaaatcaa(AAAT)3 | c | 55700 | 55810 | 111 | Design Primer |