Compound Compound Repeats of Papilio bianor mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_018040 | (A)10tc(TAAA)3 | c | 6354 | 6377 | 24 | Design Primer |
| 2 | NC_018040 | (A)10ctatattttctataataaaataaattat(A)10 | c | 7943 | 7990 | 48 | Design Primer |
| 3 | NC_018040 | (A)11tcaaataatttcttgat(A)11 | c | 12056 | 12094 | 39 | Design Primer |
| 4 | NC_018040 | (A)11ttacgctgttatccctaaggtaattttttcttttaatcattattaatgga(TCAT)3 | c | 12907 | 12979 | 73 | Design Primer |
| 5 | NC_018040 | (T)10ccttcataataattattaaatacctaaattgctatataaaattttataaattaataa(ATTAT)3 | c | 15071 | 15152 | 82 | Design Primer |