Compound Compound Repeats of Aspergillus nidulans FGSC A4 mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_017896 | (TA)6atatatgtct(TTA)4 | c | 11890 | 11923 | 34 | Design Primer |
| 2 | NC_017896 | (AT)6taataataaatccac(A)11 | c | 19257 | 19294 | 38 | Design Primer |
| 3 | NC_017896 | (ATT)4t(TAA)4tgaaatagacttggttatatatcaagcttaatattatataataaattatattaatattaatac(AAAT)3 | c | 22490 | 22589 | 100 | Design Primer |
| 4 | NC_017896 | (TA)7gtttatatattgtgtttagtaaaattaaaacactagtttaataatatgatatgatagttttatataataaatactttataagt(A)10ttcaattgttaagcctataaaaaatttatgaaaattatttattaaataaggttaatgt(A)13 | c | 25426 | 25603 | 178 | Design Primer |