Compound Compound Repeats of Amblyomma elaphense mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_017758 | (AAT)4ttttattattttaaata(T)12 | c | 3535 | 3575 | 41 | Design Primer |
| 2 | NC_017758 | (A)10ttaaagcttatcccataatttttcttaaataatattatttattaa(ATT)4 | c | 7618 | 7684 | 67 | Design Primer |
| 3 | NC_017758 | (TA)6tgataatgagattttaccataaattattatcattattaataaaggaattgatcctaataatgt(ATAA)4atagctgcttgaaatcgctcaggttggtttcctcaaccaaaaattattatgattattggaaataaagtacactc(A)10 | c | 11743 | 11917 | 175 | Design Primer |