Compound Compound Repeats of Phalaenopsis equestris chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_017609 | (T)10catctttagagcgatagtatatgtcgtaaaataggtgatctatttccttaaaaaaaatg(ATCTT)3 | c | 7968 | 8051 | 84 | Design Primer |
2 | NC_017609 | (TTA)4atggaatttgagaattctcaaatttattagttatggttatgcttttattc(T)11 | c | 14181 | 14253 | 73 | Design Primer |
3 | NC_017609 | (TA)6agtcaagtaagtcaagtgaatctttttccgatggaaaagtcaacaaagcaagtagggttgaccttgaaacaattcaatgca(T)10 | c | 33282 | 33384 | 103 | Design Primer |
4 | NC_017609 | (A)10tttcaaaaagattgaaattcttcattttcaaatggaagtataacactagcttcagttatttttatttgtagcgaagttcattataatg(A)10 | c | 59871 | 59978 | 108 | Design Primer |
5 | NC_017609 | (T)10cttttctaacttttagaaagga(T)12 | c | 120270 | 120313 | 44 | Design Primer |
6 | NC_017609 | (A)12ttgtgacatttcattgcgtaaagcattttctaatttatcattttttatatatcgtaatggacgattccatcgcttataatc(A)10 | c | 121947 | 122049 | 103 | Design Primer |