Compound Repeats of Ginkgo biloba chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_016986 | (A)12gagagaggaatgaaaaactaacatagatgttatggatccaattcatagaacaattcggatttgatagaaaaagaagag(A)10 | c | 11482 | 11581 | 100 | Design Primer |
2 | NC_016986 | (TA)9ttcatcttatatgttatgtacgcatgtacgaatggatagatatttcttaatctatt(TA)7 | c | 63749 | 63836 | 88 | Design Primer |
3 | NC_016986 | (TATC)4(TA)8 | c | 104673 | 104704 | 32 | Design Primer |
4 | NC_016986 | (TA)6(GATA)3 | c | 116762 | 116785 | 24 | Design Primer |
5 | NC_016986 | (A)33tacgttccgataaaag(A)12 | c | 135244 | 135304 | 61 | Design Primer |
6 | NC_016986 | (TATC)3(TA)6 | c | 139460 | 139483 | 24 | Design Primer |
7 | NC_016986 | (TA)8(GATA)4 | c | 151541 | 151572 | 32 | Design Primer |