Compound Repeats of Peltigera membranacea mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_016957 | (AT)6ttatatttatatataggaaaagttgctattggtaaagcgagatatttgctaaatattgtgtaataaacacatggatgttcgaatcatcttttttccg(A)10 | c | 4108 | 4226 | 119 | Design Primer |
2 | NC_016957 | (A)10taagacctaaaaatatttacgactagaataa(AAAT)3 | c | 10651 | 10703 | 53 | Design Primer |
3 | NC_016957 | (TTA)4attatgttta(GTTT)3a(T)10 | c | 27023 | 27067 | 45 | Design Primer |
4 | NC_016957 | (TTTAT)3aatttttagcttacacataataatgtataagttttaagatatttataaaatacatcat(TAG)4 | c | 60480 | 60564 | 85 | Design Primer |