Compound Compound Repeats of Silene conica chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_016729 | (T)10(G)10 | c | 25141 | 25160 | 20 | Design Primer |
| 2 | NC_016729 | (A)10gaatctggctaatataacaaggacattaaaaaataaaatagaaagatttacaaaagaaaaaaattttgaatcacctcaaaatctcggtcagatatt(A)15 | c | 104904 | 105024 | 121 | Design Primer |
| 3 | NC_016729 | (AC)6(A)14 | c | 106477 | 106502 | 26 | Design Primer |
| 4 | NC_016729 | (T)14(GT)6 | c | 120836 | 120861 | 26 | Design Primer |
| 5 | NC_016729 | (T)15aatatctgaccgagattttgaggtgattcaaaatttttttcttttgtaaatctttctattttattttttaatgtccttgttatattagccagattc(T)10 | c | 122314 | 122434 | 121 | Design Primer |