Compound Repeats of Libythea celtis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_016724 | (AT)6cataactaattatacttaaatataataatatt(A)10 | c | 9577 | 9630 | 54 | Design Primer |
| 2 | NC_016724 | (TAA)4tagta(ATTT)3 | c | 10325 | 10353 | 29 | Design Primer |
| 3 | NC_016724 | (TTA)6aaataga(T)19 | c | 14835 | 14878 | 44 | Design Primer |