Compound Compound Repeats of Gossypium arboreum chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_016712 | (T)10caattgaaaattccc(AAT)4 | c | 13525 | 13561 | 37 | Design Primer |
2 | NC_016712 | (C)13tttttttcctaatca(T)10 | c | 14675 | 14712 | 38 | Design Primer |
3 | NC_016712 | (T)11atttttattttaaggaattgcttagtcgtctagtaacaagtaagagtagtcgttagatatagat(A)10 | c | 69371 | 69455 | 85 | Design Primer |
4 | NC_016712 | (T)10cggaaaagttcaaaaatactatgatggctccgttgctttatatatttatttcgtctgtgattcagcaatcccaaagtttc(T)10 | c | 74595 | 74694 | 100 | Design Primer |