Compound Compound Repeats of Gossypium tomentosum chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_016690 | (T)10caattgaaaattccc(AAT)4 | c | 13570 | 13606 | 37 | Design Primer |
2 | NC_016690 | (T)10cttttttcaatctaaattggactaaatt(G)11 | c | 67405 | 67453 | 49 | Design Primer |
3 | NC_016690 | (T)10atttttattttaaggaattgcttagtcgtctagtaacaagtaagagtagtcgttagatatagat(A)10 | c | 69574 | 69657 | 84 | Design Primer |
4 | NC_016690 | (TTA)4tttttttcccctctttttttgatttc(T)12 | c | 103943 | 103992 | 50 | Design Primer |
5 | NC_016690 | (A)12gaaatcaaaaaaagaggggaaaaa(AAT)4 | c | 145352 | 145399 | 48 | Design Primer |