Compound Repeats of Neottia nidus-avis plastid
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_016471 | (A)10tttgaatacagaattacacaaaaatagttacaagttacactaacctttt(TTTA)3 | c | 2961 | 3031 | 71 | Design Primer |
| 2 | NC_016471 | (ATA)4agg(ATA)4 | c | 63059 | 63085 | 27 | Design Primer |
| 3 | NC_016471 | (A)12ttgtgacatttcattgcgtaaagcattttctaatttatcattttttatatatcgtaatggacgattccaccgtttataatc(A)10 | c | 67611 | 67713 | 103 | Design Primer |