Compound Repeats of Eleutherococcus senticosus chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_016430 | (C)11(A)13 | c | 23924 | 23947 | 24 | Design Primer |
2 | NC_016430 | (AAGA)3aatatatgaa(TCTT)3 | c | 31042 | 31075 | 34 | Design Primer |
3 | NC_016430 | (T)10caagcgtggaaaccccagaacctgaagtagtaggatttattctc(ATA)4 | c | 56961 | 57026 | 66 | Design Primer |
4 | NC_016430 | (TA)6acatatttaaatataaacaaaccaaatcc(TATT)3 | c | 70390 | 70442 | 53 | Design Primer |