Compound Repeats of Silene noctiflora mitochondrion chromosome 1
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_016393 | (A)11taagaaagtaaatccctttaatatttttatattagaataattgcagctacggacataaagaagaaaaagc(AGAA)3 | c | 25310 | 25402 | 93 | Design Primer |
2 | NC_016393 | (A)10ccttcaagttt(TAA)4 | c | 161032 | 161064 | 33 | Design Primer |
3 | NC_016393 | (T)11cg(A)10 | c | 190957 | 190979 | 23 | Design Primer |