Compound Repeats of Silene noctiflora mitochondrion chromosome 23
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_016364 | (G)11a(T)10 | c | 6411 | 6432 | 22 | Design Primer |
2 | NC_016364 | (T)10ctcgcagtgacgtgctctctttgttaagtaacaaaacactagtgccagtcgccgtcgatgctgcttcttgctatgctatgaaatgc(A)10 | c | 24654 | 24759 | 106 | Design Primer |
3 | NC_016364 | (TCACT)3tcgggatgagcgaccagaaagagaagtcccttgctctatatgcttattctgcgttct(CTTG)3 | c | 100090 | 100173 | 84 | Design Primer |