Compound Compound Repeats of Silene noctiflora mitochondrion chromosome 18
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_016357 | (T)11agattttcgag(A)10 | c | 3195 | 3226 | 32 | Design Primer |
| 2 | NC_016357 | (T)12ctttttcgaagcttaggatccag(GGTT)3 | c | 9796 | 9842 | 47 | Design Primer |
| 3 | NC_016357 | (A)13gcttttccccttacactcggattcttgcatcaaattgttccatgcgttcagcgttcatcccaaacgcaaaagtctctttttcaataa(T)10 | c | 112747 | 112856 | 110 | Design Primer |