Compound Compound Repeats of Silene noctiflora mitochondrion chromosome 6
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_016355 | (TAAAA)3gaaggcttatgcccagaaaagccaaaaaccaacgaagctgagttcataaggaagactgccccctcacacccg(A)10 | c | 9726 | 9822 | 97 | Design Primer |
2 | NC_016355 | (CTT)4tagtgaacttggtatagtgagctttc(T)11 | c | 74960 | 75008 | 49 | Design Primer |
3 | NC_016355 | (A)14tgtagttgaagcttttgaaacagctgattccggtgatcggttgatataagttaattaggtagttctcattctcccaagtattccgctcgatgag(A)11 | c | 113221 | 113339 | 119 | Design Primer |
4 | NC_016355 | (CTA)4taatatgcatctaactttctttcccctttacattcgtctggagctttc(T)10 | c | 124639 | 124708 | 70 | Design Primer |
5 | NC_016355 | (A)11gctgtttgcttaacacacgcaaattggacgagggtttcaaaggaaaaccacaggaa(AG)6 | c | 130595 | 130673 | 79 | Design Primer |