Compound Compound Repeats of Silene conica mitochondrion chromosome 12
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_016226 | (ATTA)3atattaattaattgtattaattaattgtattaattgctcctctttttgc(ATTA)3 | c | 46279 | 46351 | 73 | Design Primer |
| 2 | NC_016226 | (AAAG)3tcacaaagagagcaaaaaggcagaaaaagc(AAAG)3 | c | 47316 | 47369 | 54 | Design Primer |
| 3 | NC_016226 | (CT)8tgctttcttcttgacttctttgctttcttttttgtaaataaaaagatcatattaattgtattaattgctcctctttttgc(ATTA)3 | c | 74441 | 74548 | 108 | Design Primer |